Home > MCAT > Quizzes > MCAT Biological and Biochemical Foundations of Living Systems: Passage 8
MCAT Biological and Biochemical Foundations of Living Systems: Passage 8
Fast practice, instant feedback. Timer auto-submits when time’s up.
Avg score: 86% Most missed: “How are miRNAs and siRNAs different from each other?”
Use the following passage to answer questions: Noncoding RNA molecules have the potential to play important roles both in the development and treatment of cancer. Of the many classes of noncoding RNA molecules, two types are dysregulated in hepatocellular carcinoma (HCC) and various other types of cancer: microRNAs (miRNAs) and long noncoding RNAs (lncRNAs). MiRNAs are short (21 to 23 nucleotides) single-stranded RNAs that are processed from longer precursor miRNAs and that are found in most organisms. This RNA species usually binds to messenger RNAs (mRNAs) that have regions of near-perfect... Show more
MCAT Biological and Biochemical Foundations of Living Systems: Passage 8
Time left 00:00
4 Questions

1. Which of the following features would lncRNAs NOT be expected to have?
2. What types of noncoding RNA species would be predicted to have the following sequences (where Nx represents x number of nucleotides)?
Sequence 1 uggagugugacaaugguguuug
Sequence 2 cccuuccuuuaucccaguggggcccagacccgcgcaaccaggcggggaggggaggugggc (N3660) ggauaguuuuuccaccuuugcccgauacaauuuaaaaaaaaaaa
3. How are miRNAs and siRNAs different from each other?
4. Which of the following properties would need to be improved to use noncoding RNA as diagnostic markers?