What types of noncoding RNA species would be predicted to have the following sequences (where Nx represents x number of nucleotides)?Sequence 1 uggagugugacaaugguguuugSequence 2 cccuuccuuuaucccaguggggcccagacccgcgcaaccaggcggggaggggaggugggc (N3660) ggauaguuuuuccaccuuugcccgauacaauuuaaaaaaaaaaa

🎲 Try a Random Question  |  Total Questions in Quiz: 4  |  🧠 Study this quiz with Flashcards
This question is part of a full practice quiz:
MCAT Biological and Biochemical Foundations of Living Systems: Passage 8 — practice the complete quiz, review flashcards, or try a random question.

Use the following passage to answer questions: Noncoding RNA molecules have the potential to play important roles both in the development and treatment of cancer. Of the many classes of noncoding RNA molecules, two types are dysregulated in hepatocellular carcinoma (HCC) and various other types of cancer: microRNAs (miRNAs) and long noncoding RNAs (lncRNAs). MiRNAs are short (21 to 23 nucleotides) single-stranded RNAs that are processed from longer precursor miRNAs and that are found in most organisms. This RNA species usually binds to messenger RNAs (mRNAs) that have regions of near-perfect... Show more

What types of noncoding RNA species would be predicted to have the following sequences (where Nx represents x number of nucleotides)?<br>Sequence 1 uggagugugacaaugguguuug<br>Sequence 2 cccuuccuuuaucccaguggggcccagacccgcgcaaccaggcggggaggggaggugggc (N3660) ggauaguuuuuccaccuuugcccgauacaauuuaaaaaaaaaaa